You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
pbpC [2018-02-16 18:28:51]
transpeptidase, penicillin-binding protein 3
Molecular weight
74.23 kDa
Product
penicillin-binding protein 3
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
463,934 → 465,940
Phenotypes of a mutant
increased sensitivity to several β-lactams PubMed The protein
Catalyzed reaction/ biological activity
cross-linking of glycan chains PubMed Protein family
transpeptidase family (according to Swiss-Prot)Structure
5E31 (from Enterococcus faecium, 40% identity) Localization
cell membrane (according to Swiss-Prot)mid cell localization (divisome), this depends on FtsZ and PBP2A PubMedextracellular (signal peptide) PubMed Expression and Regulation
Biological materials
Mutant
BKE04140 (ΔpbpC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGACTTTCCCCTGCCTTC, downstream forward: _UP4_TAAAATGTCTTTTTAAAAGGBKK04140 (ΔpbpC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGACTTTCCCCTGCCTTC, downstream forward: _UP4_TAAAATGTCTTTTTAAAAGG GFP fusion
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jeff Errington lab References
Loading