pxpB

subunit of ATP-dependent 5-oxoprolinase, inhibitor of KinA, control of the phosphorelay

Locus: BSU_04080

Isoelectric point: 4.66

Molecular weight: 26.57 kDa

Protein length: 240 aa

Gene length: 723 bp

Function: detoxification of 5-oxoproline, control of the phosphorelay, initiation of sporulation

Product: subunit of 5-oxoprolinase, inhibitor of KinA

Essential: no

Synonyms: kipI,ycsJ

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Detoxification reactions
• Information processing → Regulation of gene expression → phosphorelay → Proteins controlling the activity of the kinases
• Lifestyles → Sporulation → phosphorelay → Proteins controlling the activity of the kinases

Gene

Coordinates: 459,867 460,589

Phenotypes of a mutant

• no growth with 5-oxoproline as single source of nitrogen PubMed
• reduced growth with ammonium as source of nitrogen due to the accumulation of toxic 5-oxoproline PubMed

The protein

Catalyzed reaction/ biological activity

• 5-oxoproline + ATP --> glutamate + ADP + P_i PubMed

Protein family

• PxpB family (single member, according to UniProt)

Kinetic information

• K_m (5-oxoproline): 39 M PubMed

Effectors of protein activity

• binding of PxpC prevents PxpB from binding to KinA PubMed

Structure

• 2ZP2 PubMed

Expression and Regulation

Operons

• Genes: pxpA-ycsG-ycsI-pxpB-pxpC-kipR-lipC
  Description: PubMed

  Regulatory mechanism

  • KipR: repression, PubMed, in KipR regulon
  • TnrA: activation, PubMed, in TnrA regulon

  Regulation

  • induced in the presence of 5-oxoproline PubMed

Biological materials

Mutant

• BKE04080 (pxpB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTTTCTCACCTCTTTTA, downstream forward: _UP4_TATAAGGAGGAGTCCAATTG
• BKK04080 (pxpB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTTTCTCACCTCTTTTA, downstream forward: _UP4_TATAAGGAGGAGTCCAATTG

References

Loading