mdh [2019-07-09 09:06:38]

malate dehydrogenase

Locus: BSU29120

Isoelectric point: 4.73

Molecular weight: 33.49 kDa

Protein length: 312 aa

Gene length: 939 bp

Function: TCA cycle

Product: malate dehydrogenase

Essential: no

E.C.: 1.1.1.37

Synonyms: citH

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Carbon core metabolism → TCA cycle
• Groups of genes → Membrane proteins
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue
• Groups of genes → Phosphoproteins → Phosphorylation on a Ser residue

Gene

Coordinates: 2,978,734 2,979,672

The protein

Catalyzed reaction/ biological activity

• (S)-malate + NAD⁺ = oxaloacetate + NADH (according to Swiss-Prot)

Protein family

• LDH/MDH superfamily (with Ldh, according to UniProt)
• MDH type 3 family (single member, according to UniProt)

Modification

• phosphorylated on Arg-156 PubMed
• phosphorylation on Ser-149 PubMed

Cofactors

• NAD⁺

Effectors of protein activity

• Inhibited by Mg2+, Ca2+, Zn2+, Ag2+ and Hg2+ PubMed PubMed
• Inhibited by oxaloacetate (above 1mM) and malate (above 7,7mM) PubMed

Structure

• 3TL2 (from B. anthracis, 85% identity)

Localization

• cytoplasm (according to UniProt)
• membrane associated PubMed

Additional information

• The enzyme is a tetramer PubMed
• extensive information on the structure and enzymatic properties of Mdh can be found at Proteopedia
• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: icd-mdh
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CcpA: repression, CcpC: transcription repression PubMed, in CcpA regulon
  • CcpC: repression, (molecular inducer: citrate) PubMed, in CcpC regulon

  Regulation

  • citZ: catabolite repression (CcpA) PubMed

• Genes: citZ-icd-mdh
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CcpA: repression, CcpC: transcription repression PubMed, in CcpA regulon
  • CcpC: repression, (molecular inducer: citrate) PubMed, in CcpC regulon
  • CitB: mRNA destabilization, upon citrate accumulation or iron limitation PubMed, in CitB regulon

  Regulation

  • CitZ: catabolite repression (CcpA) PubMed

Biological materials

Mutant

• GP719(spc) & GP1150(spc), available in Jörg Stülke's lab PubMed
• GP790 Δ(citZ-icd-mdh)::kan, available in Jörg Stülke's lab
• GP2331 Δ(citZ-icd-mdh)::kan, Cre-recombinase is integrated in sacA,available in Jörg Stülke's lab
• GP2333 Δ(citZ-icd-mdh)::lox72, Cre-recombinase is integrated in sacA, available in Jörg Stülke's lab
• BKE29120 (mdh::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTCTCTCTTCTCCTTTA, downstream forward: _UP4_TAATAAAAAGAGAGAAAGGC
• BKK29120 (mdh::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTCTCTCTTCTCCTTTA, downstream forward: _UP4_TAATAAAAAGAGAGAAAGGC

Expression vectors

• pGP385: for expression, purification in E. coli with N-terminal His-tag, in pWH844, available in Jörg Stülke's lab
• pGP1123 (N-terminal Strep-tag, for SPINE, purification from B. subtilis, in pGP380) (available in Jörg Stülke's lab) PubMed
• pGP1755 (expression / purification of Mdh-S149A, with N-terminal His-tag from E. coli, in pWH844), available in Jörg Stülke's lab
• pGP1764 (for expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab)
• GP1438(mdh-Strep (spc)) & GP1440(mdh-Strep (cat)), purification from B. subtilis, for SPINE, available in Jörg Stülke's lab

GFP fusion

• GP1431 (spc, based on pGP1870), available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

FLAG-tag construct

• GP1130 (spc, based on pGP1331), available in Jörg Stülke's lab PubMed

Antibody

• **

References

Loading