ndh [2019-06-25 09:04:29]

NADH dehydrogenase (Menaquinone 7 & no proton)

Locus: BSU12290

Isoelectric point: 6.29

Molecular weight: 41.79 kDa

Protein length: 392 aa

Gene length: 1179 bp

Function: respiration

Product: NADH dehydrogenase (Menaquinone 7 & no proton)

Essential: no

Synonyms: yjlD

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Electron transport and ATP synthesis → Respiration → Respiration/ other
• Information processing → Genetics → Newly identified competence genes
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,299,074 1,300,252

Phenotypes of a mutant

• inactivation of ndh facilitates without a wall (due to reduction of oxidative stress) PubMed
• poor growth PubMed
• non-transformable PubMed

The protein

Protein family

• NADH dehydrogenase family (according to Swiss-Prot)

Paralogous protein(s)

• YumB

Cofactors

• FAD (according to UniProt)

Structure

• 4NWZ (from C. thermarum, 42% identity) PubMed

Localization

• membrane associated PubMed

Additional information

• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: yjlC-ndh
  Description: PubMed

  Regulatory mechanism

  • Rex: repression, PubMed, in Rex regulon
  • stringent response: negative regulation, in stringent response
  • ResD: repression, PubMed, in ResD regulon

  Regulation

  • induced at high NADH⁺ levels (Rex) PubMed
  • repressed under anaerobic conditions (ResD) PubMed

• Genes: yjlB-yjlC-ndh
  Description: PubMed

Biological materials

Mutant

• MGNA-A358 (yjlD::erm), available at the NBRP B. subtilis, Japan
• BKE12290 (ndh::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCGTATATCCTCCGTCCT, downstream forward: _UP4_TAATCCTTTTAATGAATCTG
• BKK12290 (ndh::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCGTATATCCTCCGTCCT, downstream forward: _UP4_TAATCCTTTTAATGAATCTG

References

Loading