cheV

modulation of CheA activity in response to attractants

Locus: BSU_14010

Isoelectric point: 4.62

Molecular weight: 34.48 kDa

Protein length: 303 aa

Gene length: 912 bp

Function: control of CheA activity

Product: CheA modulator

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Control of two-component response regulators → Control of response regulators/ other
• Lifestyles → Exponential and early post-exponential lifestyles → Motility and chemotaxis → Signal transduction in motility and chemotaxis → Coupling proteins
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Other proteins required for efficient pellicle biofilm formation
• Groups of genes → Phosphoproteins → Phosphorylation on an Asp residue

Gene

Coordinates: 1,473,605 1,474,516

Phenotypes of a mutant

• cheV cheW double mutants exhibit complete loss of chemotaxis PubMed
• not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation PubMed

The protein

Paralogous protein(s)

• CheW:

Domains

• N-terminal CheW-like domain, C-terminal two-component receiver domain PubMed
• Response regulatory domain (aa 176-302) (according to UniProt)
• CheW-like domain (aa 16-154) (according to UniProt)

Modification

• the C-terminal two-component receiver domain is phosphorylated on a Asp residue by CheA PubMed

Localization

• forms lateral clusters (phosphorylated form), but in the presence of high asparagine concentration (non-phosphorylated form) there is a reversible re-localization to the poles of the cell PubMed

Expression and Regulation

Operons

• Genes: cheV
  Description: PubMed

  Sigma factors

  • SigD: sigma factor, PubMed, in SigD regulon

  Additional information

  • in minimal medium, CheV is present with 7,500 /- 2,000 molecules per cell PubMed

Biological materials

Mutant

• DS70 (cheV::mls in NCIB3610) PubMed
• BKE14010 (cheV::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATTCAATCCCTCGCTATT, downstream forward: _UP4_TAAATAAAAACAGCCGTTGC
• BKK14010 (cheV::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATTCAATCCCTCGCTATT, downstream forward: _UP4_TAAATAAAAACAGCCGTTGC

References

Reviews

Loading

Original publications

Loading