pucR

transcriptional regulator of puc genes

Locus: BSU_32420

Isoelectric point: 6.19

Molecular weight: 60.34 kDa

Protein length: 531 aa

Gene length: 1596 bp

Function: regulation of purine utilization

Product: transcriptional regulator of puc genes (PucR family)

Essential: no

Synonyms: yunI

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Nucleotide metabolism → Utilization of nucleotides
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other

Gene

Coordinates: 3,328,762 3,330,357

The protein

Protein family

• PucR family
• CdaR family (according to UniProt)

Additional information

• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: pucR-pucJ-pucK-pucL-pucM
  Description: PubMed

  Regulatory mechanism

  • PucR: auto-repression, PubMed, in PucR regulon
  • TnrA: activation, PubMed, in TnrA regulon

  Regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) (TnrA) PubMed

Biological materials

Mutant

• MGNA-A934 (yunI::erm), available at the NBRP B. subtilis, Japan
• BKE32420 (pucR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGCGCATTCTCCTTTTC, downstream forward: _UP4_TAAAGTTTGTTACATTTTCT
• BKK32420 (pucR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGCGCATTCTCCTTTTC, downstream forward: _UP4_TAAAGTTTGTTACATTTTCT

References

Loading