You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yaaN
Molecular weight
43.67 kDa
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
36,478 37,638
The protein
Protein family
TelA family (together with YceH) (according to UniProt) Paralogous protein(s)
Expression and Regulation
Biological materials
Mutant
MGNA-B895 (yaaN::erm), available at the NBRP B. subtilis, JapanBKE00260 (yaaN::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GTTCATCGCTCTTACCCTCT, downstream forward: _UP4_TGATTACCAGTAAGTCTGGCBKK00260 (yaaN::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GTTCATCGCTCTTACCCTCT, downstream forward: _UP4_TGATTACCAGTAAGTCTGGCGP640 (yaaN::kan trpC2), available in Jörg Stülke's lab Expression vector
pGP2842: IPTG inducible expression, purification in E. coli with C-terminal Strep-tag, in pGP574, available in Jörg Stülke's labpGP2843: expression of Strep-yaaN by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab References
Loading