cwlO

D,L-endopeptidase-type autolysin, primary autolytic pathway for cell elongation

Locus: BSU_34800

Isoelectric point: 5.33

Molecular weight: 50.87 kDa

Protein length: 473 aa

Gene length: 1422 bp

Function: cell wall synthesis, cell elongation

Product: endopeptidase-type autolysin

Essential: no

Synonyms: yzkA,yvcE

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Autolytic activity required for peptidoglycan synthesis (cell elongation)
• Cellular processes → Cell envelope and cell division → Cell wall degradation/ turnover → Autolysis
• Cellular processes → Cell envelope and cell division → Cell wall degradation/ turnover → Endopeptidases
• Groups of genes → Secreted proteins

Gene

Coordinates: 3,574,363 3,575,784

Phenotypes of a mutant

• a cwlO lytE mutant is not viable PubMed
• shorter, fatter cells, this can be rescued by addition of Mg(2+) PubMed
• loss of genetic competence PubMed

The protein

Catalyzed reaction/ biological activity

• cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) PubMed
• degradation of gamma-polyglutamic acid PubMed

Protein family

• Peptidase C40 family (according to UniProt)

Domains

• C-terminal D,L-endopeptidase domain (NlpC/P60 domain) PubMed

Effectors of protein activity

• CwlO requires activation by FtsE-FtsX PubMed
• activity requires functional Mbl PubMed
• both enzymatic activities are inhibited by interaction with IseA PubMed

Localization

• extracellular (signal peptide) PubMed
• localizes to the outer lateral sidewall of the cell (via the N-terminal domain) PubMed
• cell membrane in a FtsX-dependent manner PubMed

Expression and Regulation

Operons

• Genes: cwlO
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • WalR: activation, PubMed, in WalR regulon

  Regulation

  • expressed during exponential growth (WalR) PubMed
  • the leader mRNA is processed by RNase Y, this requires the YmcA-YlbF-YaaT complex PubMed

Biological materials

Mutant

• GP2642 (cwlO::aphA3), available in Jörg Stülke's lab
• MGNA-B643 (yvcE::erm), available at the NBRP B. subtilis, Japan
• BKE34800 (cwlO::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTTTTTATATCCTCCCTT, downstream forward: _UP4_TAATAAATATGACAAGGGCC
• BKK34800 (cwlO::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTTTTTATATCCTCCCTT, downstream forward: _UP4_TAATAAATATGACAAGGGCC

References

Reviews

Loading

Original publications

Loading