cssS [2019-08-09 11:34:20]

two-component sensor kinase, control of cellular responses to protein secretion stress

Locus: BSU_33020

Isoelectric point: 5.80

Molecular weight: 51.92 kDa

Protein length: 451 aa

Gene length: 1356 bp

Function: control of cellular responses to protein secretion stress

Product: two-component sensor kinase

Essential: no

Synonyms: yvqB

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein kinases
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of two-component response regulators → Two-component sensor kinase
• Lifestyles → Coping with stress → Heat shock proteins
• Groups of genes → Membrane proteins
• Groups of genes → Phosphoproteins → Phosphorylation on a His residue

Gene

Coordinates: 3,386,398 3,387,753

The protein

Catalyzed reaction/ biological activity

• autophosphorylation, phosphorylation of CssR

Paralogous protein(s)

• YclK, YvrG, YkoH, KinE

Domains

• two transmembrane segments, C-terminal histidine phosphotransferase domain

Modification

• autophosphorylation on a His residue

Effectors of protein activity

• the extracellular loop domain is required for signal perception PubMed

Localization

• cell membrane (according to Swiss-Prot)
• localized primarily at the division septum but also found in a punctate pattern with lower intensity throughout the cell cylinder PubMed

Expression and Regulation

Operons

• Genes: cssR-cssS
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CssR: activation, PubMed, in CssR regulon

  Regulation

  • expressed under conditions of secretion stress (CssR) PubMed

Biological materials

Mutant

• MGNA-B216 (yvqB::erm), available at the NBRP B. subtilis, Japan
• BKE33020 (cssS::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TTTCATGATGACATCATCCT, downstream forward: _UP4_TAGACTGTAGATGTTTTGCA
• BKK33020 (cssS::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TTTCATGATGACATCATCCT, downstream forward: _UP4_TAGACTGTAGATGTTTTGCA

References

Reviews

Loading

Original Publications

Loading