rsiW

anti-[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]

locus: BSU_01740

pI: 6.65

mw: 23.19 kDa

protein length: 208 aa

gene length: 627 bp

function: control of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW] activity

product: anti-[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]

essential: no

synonyms: ybbM

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 195,426 196,052

The protein

Protein family

• zinc-associated anti-sigma factor (ZAS) superfamily (with [protein|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|YlaD], according to UniProt)
• anti-sigma-W factor family (single member, according to UniProt)

[SW|Domains]

• The cytoplasmic domain is able to inactivate SigW and the extracellular and transmembrane domains are crucial for sensing and transducing the signal that triggers SigW activation (PubMed:15130127). The N-terminus binds the zinc ion and is followed by a long helix (about residues 40-80) that fits into a hydrophobic surface groove on SigW, probably blocking its ability to interact with the -10 and -35 promoter elements (PubMed:28319136).

Effectors of protein activity

• degraded by [protein|CB50289535EA537F63BADD459BD11AA7759A6658|RasP] and [protein|EE3B6B52EA19958E2E46A1545747F5209A6AA036|PrsW] under conditions of alkali shock or in the presence of antimicrobial peptides, respectively. This results in the release of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]

Structure

• [PDB|5WUQ] (the cytoplasmic domain in complex with [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]) [pubmed|28319136]

[SW|Localization]

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• genes: [gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]-[gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]
  description: [Pubmed|12207695]

  sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]

  regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12076816], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]

  regulation

  • induced under conditions of alkali shock or in the presence of the toxin [protein|search|SdpC] ([protein|search|SigW]) [Pubmed|12207695]

  additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]

Biological materials

Mutant

• MGNA-B953 (ybbM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1952 NBRP B. subtilis, Japan]
• BKE01740 ([gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGACAGCTCATTTCATCAC, downstream forward: _UP4_TAAAGCGCGTTAGCCGCTTT
• BKK01740 ([gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGACAGCTCATTTCATCAC, downstream forward: _UP4_TAAAGCGCGTTAGCCGCTTT

labs

• [SW|Thomas Wiegert], University of Bayreuth, Germany [http://www.genetik.uni-bayreuth.de/LSGenetik1/Thomas%20Wiegert-Dateien/Thomas%20Wiegert.html Homepage]

References

Reviews

• 20836086,22381678,29343670

Original Publications

• 17020587,14993308,16816000,18599827,12207695,16899079,15130127,12884008,12076816,19889088,14993308,28319136,28674070