dgcP

diguanylate cyclase

locus: BSU_29650

pI: 5.70

mw: 65.30 kDa

protein length: 579 aa

gene length: 1740 bp

function: synthesis of c-di-GMP

product: diguanylate cyclase

essential: no

synonyms: ytrP

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]

Gene

Coordinates: 3,033,696 3,035,435

The protein

Catalyzed reaction/ biological activity

• synthesis of c-di-GMP from two molecules of GTP [Pubmed|23893111]

[SW|Domains]

• contains an N-terminal GAF domain [Pubmed|23893111]
• contains a C-terminal [SW|GGDEF domain] [Pubmed|22821967]

[SW|Localization]

• cytoplasma, forms subcellular clusters at the periphery of exponentially growing cells [pubmed|28536559]

additional information

• DgcP is present with about 25 molecules per cell [pubmed|32156823]

Expression and Regulation

Operons

• genes: [gene|4C577B2CEDD9CD2CBFAF036EF36C9EFAF16F923F|dgcP]
  description: [pubmed|22383849]

Biological materials

Mutant

• MGNA-A425 (ytrP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/425 NBRP B. subtilis, Japan]
• GP1591 (tet) available in [SW|Jörg Stülke]'s lab
• BKE29650 ([gene|4C577B2CEDD9CD2CBFAF036EF36C9EFAF16F923F|dgcP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTTATCACCTAAAA, downstream forward: _UP4_TAAAAAAAGCCCAAAACGAT
• BKK29650 ([gene|4C577B2CEDD9CD2CBFAF036EF36C9EFAF16F923F|dgcP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTTATCACCTAAAA, downstream forward: _UP4_TAAAAAAAGCCCAAAACGAT

References

• 23893111,22821967,28536559,32156823