tuaA/1

lipid carrier sugar transferase, disrupted pseudogene in B. subtilis 168

Locus: BSU_35609

Isoelectric point: 0.00

Molecular weight: 0.00 kDa

Protein length: 49 aa

Gene length: 150 bp

Function: biosynthesis of teichuronic acid

Product: lipid carrier sugar transferase

Essential: no

Synonyms: yvhA

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Biosynthesis of teichuronic acid
• Metabolism → Additional metabolic pathways → Biosynthesis of cell wall components → Biosynthesis of teichuronic acid
• Groups of genes → Pseudogenes

Gene

Coordinates: 3,658,259 3,658,408

The protein

Catalyzed reaction/ biological activity

• di-trans,octa-cis-undecaprenyl phosphate + UDP-N-acetyl-α-D-galactosamine --> N-acetyl-α-D-galactosaminyl-1-diphospho-di-trans,octa-cis-undecaprenol + UMP (according to UniProt)

Protein family

• Bacterial sugar transferase family (with EpsL, according to UniProt)

Paralogous protein(s)

• EpsL

Expression and Regulation

Operons

• Genes: tuaA/2-tuaA/1-tuaB-tuaC-tuaD-tuaE-tuaF-tuaG-tuaH
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigF: sigma factor, PubMed, in SigF regulon

  Regulatory mechanism

  • PhoP: activation, PubMed, in PhoP regulon

  Regulation

  • expressed during sporulation in the forespore (SigF) PubMed

Biological materials

Mutant

• BKE35609 (tuaA/1::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_ATCGTAACCGCCGTTCACCT, downstream forward: _UP4_TAAAACGGGATTCCATTATT
• BKK35609 (tuaA/1::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_ATCGTAACCGCCGTTCACCT, downstream forward: _UP4_TAAAACGGGATTCCATTATT

References

Loading