ilvH [2018-12-03 16:10:36]

acetolactate synthase (small subunit)

Locus: BSU28300

Isoelectric point: 10.30

Molecular weight: 19.31 kDa

Protein length: 174 aa

Gene length: 522 bp

Function: biosynthesis of branched-chain amino acids

Product: acetolactate synthase (small subunit)

Essential: no

E.C.: 2.2.1.6

Synonyms: ilvN

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of branched-chain amino acids

Gene

Coordinates: 2,894,733 → 2,895,251

The protein

Catalyzed reaction/ biological activity

• 2 pyruvate = 2-acetolactate + CO₂ (according to Swiss-Prot)

Protein family

• acetolactate synthase small subunit family (according to Swiss-Prot)

Effectors of protein activity

• subject to feedback inhibition by valine PubMed

Structure

• 2F1F (regulatory subunit from Escherichia coli, 37% identity, 62% similarity) PubMed

Expression and Regulation

Operons

• Genes: ilvB-ilvH-ilvC-leuA-leuB-leuC-leuD
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • T-box: termination/antitermination, via tRNA controlled RNA switch, repression by BCAA, in T-box
  • TnrA: repression, PubMed, in TnrA regulon
  • CodY: repression, PubMed PubMed, in CodY regulon
  • CcpA: activation, PubMed, in CcpA regulon

  Regulation

  • expression is stimulated in the presence of glucose (CcpA) PubMed

  Additional information

  • An antisense RNA is predicted for leuA PubMed
  • the T-box RNA is degraded by RNase Y PubMed

Biological materials

Mutant

• BKE28300 (ΔilvH::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAGTCAATGTGATAATTC, downstream forward: _UP4_TAAAACATAACAAGGGAGAG
• BKK28300 (ΔilvH::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAGTCAATGTGATAATTC, downstream forward: _UP4_TAAAACATAACAAGGGAGAG

References

Loading