msmX [2019-05-30 18:07:51]

multiple sugar ABC transporter (ATP-binding protein)

Locus: BSU38810

Isoelectric point: 7.39

Molecular weight: 41.21 kDa

Protein length: 365 aa

Gene length: 1098 bp

Function: uptake of maltodextrin, melibiose (probably), and galactooligosaccharides

Product: multiple sugar ABC transporter (ATP-binding protein)

Essential: no

Synonyms: yxkG

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of carbon sources
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of melibiose
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of starch/ maltodextrin
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of galactan
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of pectin
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,984,133 3,985,230

Phenotypes of a mutant

• no growth with pectin or galactan as single carbon source PubMed

The protein

Protein family

• ABC transporter superfamily (according to UniProt)

Paralogous protein(s)

• YurJ, OpuBA

Structure

• 1G29 (from Thermococcus litoralis, 54% identity) PubMed

Localization

• cell membrane (via AraP-AraQ) and MdxF-MdxG PubMed

Expression and Regulation

Operons

• Genes: yxkF-msmX
  Description: PubMed

  Regulatory mechanism

  • CcpA: repression, PubMed, in CcpA regulon

  Regulation

  • repressed by glucose (CcpA) PubMed

Biological materials

Mutant

• MGNA-B741 (msmX::erm), available at the NBRP B. subtilis, Japan
• BKE38810 (msmX::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTAACATCCCCCTTTGT, downstream forward: _UP4_TAAGATCAAAAAAACCGGAC
• BKK38810 (msmX::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTAACATCCCCCTTTGT, downstream forward: _UP4_TAAGATCAAAAAAACCGGAC

References

Loading