degQ

stimulates production of degradative enzymes and of extracellular poly-gamma-glutamate, stimulates phosphorylation of DegU by DegS, gene is not expressed in the lab strain 168 due to promoter down mutation in the -10 region (T - 10 ---> C)

locus: BSU_31720

pI: 6.54

mw: 5.41 kDa

protein length: 46 aa

gene length: 141 bp

function: regulation of exoenzyme synthesis

product: pleiotropic regulator

essential: no

synonyms: sacQ

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
• [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
• [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.4|Regulation]

Gene

Coordinates: 3,257,092 3,257,232

Phenotypes of a mutant

• loss of poly-gamma-glutamate production [Pubmed|16091050], no synthesis of nonribosomal peptides iturin A and plipastatin [http://www.ncbi.nlm.nih.gov/sites/entrez/16251307 PubMed1] [http://www.ncbi.nlm.nih.gov/sites/entrez/10471562 PubMed2], reduced synthesis of degradative enzymes [Pubmed|3098732], increased genetic competence [Pubmed|3098732]

The protein

Catalyzed reaction/ biological activity

• stimulates autophosphorylation of [protein|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|DegS] [Pubmed|21965392]

Protein family

• degQ family (single member, according to UniProt)

Expression and Regulation

Operons

• genes: [gene|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|degQ]
  description: [Pubmed|3007431]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3007431], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  regulatory mechanism

  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, [Pubmed|1901055], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [Pubmed|1901055], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]

  regulation

  • controlled by [protein|search|DegU] [Pubmed|1901055]

  additional information

  • the gene is not expressed in the lab strain 168 due to promoter down mutation in the -10 region (T - 10 ---> C) [http://www.ncbi.nlm.nih.gov/sites/entrez/16091050 PubMed]

Biological materials

Mutant

• QB4851 (cat), available in [SW|Jörg Stülke]'s lab
• BKE31720 ([gene|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|degQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTTCCACACTCCTTT, downstream forward: _UP4_TGAAAAAGACTTGGAAACAA
• BKK31720 ([gene|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|degQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTTCCACACTCCTTT, downstream forward: _UP4_TGAAAAAGACTTGGAAACAA

References

• 17850253,2428811,19447339,3007431,1901055,16091050,21278284,21965392,26302846,27920766,31272833