spoVV

transporter for dipicolinic acid across the outer forespore membrane

Locus: BSU_15030

Isoelectric point: 10.27

Molecular weight: 44.68 kDa

Protein length: 408 aa

Gene length: 1227 bp

Function: transport of dipicolinic acid across the outer forespore membrane

Product: dipicolinic acid transporter

Essential: no

Synonyms: ylbJ

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Other transporters
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,570,574 1,571,800

Phenotypes of a mutant

• inactivation of spoVV eliminates sporulation PubMed, this can be suppressed by inactivation of the genes of the gerAA-gerAB-gerAC operon PubMed

The protein

Catalyzed reaction/ biological activity

• transport of dipicolinic acid across the outer forespore membrane PubMed

Localization

• outer forespore membrane PubMed

Expression and Regulation

Operons

• Genes: spoVV
  Description: PubMed

  Sigma factors

  • SigE: sigma factor, PubMed, in SigE regulon

  Regulatory mechanism

  • SpoIIID: repression, PubMed, in SpoIIID regulon

  Regulation

  • expressed during sporulation in the mother cell (SigE) PubMed

Biological materials

Mutant

• MGNA-B246 (ylbJ::erm), available at the NBRP B. subtilis, Japan
• BKE15030 (spoVV::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTTACCTCCCCGATGC, downstream forward: _UP4_ACAAAAAAAGGATGAGTCAA
• BKK15030 (spoVV::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTTACCTCCCCGATGC, downstream forward: _UP4_ACAAAAAAAGGATGAGTCAA

References

Loading