mreBH

cell shape-determining protein, forms filaments, the polymers control/restrict the mobility of the cell wall elongation enzyme complex, required for LytE activity

Locus: BSU_14470

Isoelectric point: 5.24

Molecular weight: 35.53 kDa

Protein length: 335 aa

Gene length: 1008 bp

Function: cell shape determation

Product: cell shape-determining protein

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell shape
• Lifestyles → Coping with stress → Heat shock proteins
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,516,574 1,517,581

The protein

Catalyzed reaction/ biological activity

• forms ring-shaped filaments in a heterologous system PubMed
• required for the activity of LytE PubMed

Protein family

• FtsA/MreB family (according to UniProt)

Paralogous protein(s)

• Mbl, MreB

Structure

• 1JCF (MreB from Thermotoga maritima, 52% identity) PubMed

Localization

• during logarithmic growth, MreBH forms discrete patches thst move processively along peripheral tracks perpendicular to the cell axis PubMed
• forms transverse bands as cells enter the stationary phase PubMed
• close to the inner surface of the cytoplasmic membrane PubMed
• reports on helical structures formed by MreBH PubMed seem to be misinterpretation of data PubMed
• normal localization depends on the presence of glucolipids, MreB forms irregular clusters in an ugtP mutant PubMed

Expression and Regulation

Operons

• Genes: mreBH-ykpC
  Description: PubMed

  Sigma factors

  • SigI: sigma factor, PubMed, in SigI regulon

  Regulatory mechanism

  • WalR: activation, PubMed, in WalR regulon

  Regulation

  • expression is increased in an ugtP mutant PubMed
  • induced at high temperature (SigI, WalR) PubMed

Biological materials

Mutant

• BKE14470 (mreBH::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTTCACCCAATCTCT, downstream forward: _UP4_TAGTCTTTACCCGCAAAATT
• BKK14470 (mreBH::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTTCACCCAATCTCT, downstream forward: _UP4_TAGTCTTTACCCGCAAAATT

References

Localization

Loading

Other original publications

Loading