pepF [2018-09-26 12:12:19]

oligoendopeptidase, inhibits sporulation upon overexpression

locus: BSU11540

pI: 5.13

mw: 69.97 kDa

protein length: 609 aa

gene length: 1827 bp

function: protein degradation

product: oligoendopeptidase

essential: no

synonyms: yjbG

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
• [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]

Gene

Coordinates: 1,231,083 → 1,233,095

The protein

Protein family

• peptidase M3B family (according to Swiss-Prot)

Paralogous protein(s)

• [protein|91C89960ABE800BB25CA48A97A5D32CC308D3D31|YusY/1]

Expression and Regulation

Operons

• genes: [gene|3F0700B5E3B944116D2F9A150F7AB4263A3E41EE|pepF]
  description: [Pubmed|22383849]

• genes: [gene|0B1F5A160ADFF3EA904122A7E43E13C5828B31BE|coiA]-[gene|3F0700B5E3B944116D2F9A150F7AB4263A3E41EE|pepF]
  description: [Pubmed|22383849]

Biological materials

Mutant

• MGNA-B154 (yjbG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1153 NBRP B. subtilis, Japan]
• 1A823 ( ''pepF''::''erm''), [Pubmed|12682299], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A823&Search=1A823 BGSC]
• BKE11540 (Δ[gene|3F0700B5E3B944116D2F9A150F7AB4263A3E41EE|pepF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGCCTGCCCACCACCTT, downstream forward: _UP4_TAAAAAAGTAAGCCTGTGCG
• BKK11540 (Δ[gene|3F0700B5E3B944116D2F9A150F7AB4263A3E41EE|pepF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGCCTGCCCACCACCTT, downstream forward: _UP4_TAAAAAAGTAAGCCTGTGCG

References

• 11741842