scaffold of the germinosome, required for clustering of germinant receptors in the spore inner membrane
Genomic Context
categories
[category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins][category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]Gene
Coordinates
158,515 159,072
Phenotypes of a mutant
defective in [SW|germination] in response to nutrients [Pubmed|24530795]The protein
Catalyzed reaction/ biological activity
required for clustering of germinant receptors in the spore inner membrane [Pubmed|21696470][SW|Domains]
has an N-terminal signal sequence and a signal for fixation to lipid [Pubmed|23335419]Structure
[PDB|4O8W] [Pubmed|24530795][SW|Localization]
outer surface of the inner spore membrane [Pubmed|23335419,21696470]inner spore membrane, spore coat, cortex, germ cell wall, some GerD is also present in the soluble fraction [Pubmed|19332816]Additional information
3,500 molecules are present per spore [Pubmed|23749970]Expression and Regulation
Operons
genes
[gene|3E5B9AC0C6F974800DE1ABF25769D24947772DCB|gerD]
description
[Pubmed|2517635]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon][protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|1906867,15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]regulation
expression level depends on sporulation conditions (medim composition, temperature) [Pubmed|22327596]additional information
3,500 molecules are present per spore [PubMed|23749970]view in new tabBiological materials
Mutant
1A677 ( ''gerD''::''erm''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A677&Search=1A677 BGSC]1G17 ( ''gerD''::''spec''), [Pubmed|15126458], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1G17&Search=1G17 BGSC]BKE01550 ([gene|3E5B9AC0C6F974800DE1ABF25769D24947772DCB|gerD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTAAGCTCCTTTCAC, downstream forward: _UP4_TAAAGGGAAAGCCGGGATCTBKK01550 ([gene|3E5B9AC0C6F974800DE1ABF25769D24947772DCB|gerD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTAAGCTCCTTTCAC, downstream forward: _UP4_TAAAGGGAAAGCCGGGATCTAntibody
available in [SW|Anne Moir] lablabs
[SW|Anne Moir], University of Sheffield, UKReferences
1906867,19332816,17122337,21725007,18556788,19332816,2517635,21696470,22327596,22493018,23335419,23749970,21398556,24530795,24752279,26731423