ribR [2019-08-08 13:19:57]

riboflavin kinase with preference for dihydroriboflavin, binds FMN riboswitches of the rib operon and of ribU to allow expression even in the presence of FMN, required for the conversion of S-methyl-cysteine to cysteine

Locus: BSU_29300

Isoelectric point: 9.28

Molecular weight: 26.08 kDa

Protein length: 230 aa

Gene length: 693 bp

Function: utilization of S-methyl-cysteine, regulation of rib operon expression

Product: riboflavin kinase with preference for dihydroriboflavin

Essential: no

Synonyms: ytnK,rbfK

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Additional metabolic pathways → Sulfur metabolism → Conversion of S-methyl cysteine to cysteine
• Groups of genes → Poorly characterized/ putative enzymes

Gene

Coordinates: 3,000,985 3,001,677

Phenotypes of a mutant

• no growth with S-methyl cysteine PubMed

The protein

Catalyzed reaction/ biological activity

• synthesis of FMNH₂ PubMed
• binds the FMN riboswitch PubMed
• prevents transcription termination of the ribD-ribE-ribA-ribH-ribT operon even in the presence of FMN or FMNH₂ PubMed
• prevents sequestration of the ribosome binding site of the ribU mRNA even in the presence of FMN or FMNH₂ PubMed
• ATP + riboflavin --> ADP + FMN + H⁺ (accordinf to UniProt)

Protein family

• RibR family (single member, according to UniProt)

Paralogous protein(s)

• RibC:

Expression and Regulation

Operons

• Genes: snaA-tcyJ-tcyK-tcyL-tcyM-tcyN-cmoO-cmoI-cmoJ-ribR-sndA-ytnM
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CymR: repression, PubMed, in CymR regulon
  • AscR: activation, PubMed, in AscR regulon

  Regulation

  • induced in the presence of methionine and taurine PubMed

Biological materials

Mutant

• MGNA-A154 (ribR::erm), available at the NBRP B. subtilis, Japan
• BKE29300 (ribR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAAAAAGTCAGCCTCCTCT, downstream forward: _UP4_GGATAGGGAAAGGAGCGGAA
• BKK29300 (ribR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAAAAAGTCAGCCTCCTCT, downstream forward: _UP4_GGATAGGGAAAGGAGCGGAA

References

Loading