mntA [2017-10-19 17:42:15]

manganese ABC transporter (binding protein, lipoprotein)

Locus: BSU30770

Isoelectric point: 6.16

Molecular weight: 33.26 kDa

Protein length: 306 aa

Gene length: 918 bp

Function: manganese uptake

Product: manganese ABC transporter (binding protein)

Essential: no

Synonyms: ytgA

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of ions
• Cellular processes → Homeostasis → Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo) → Manganese
• Groups of genes → Secreted proteins

Gene

Coordinates: 3,145,038 → 3,145,958

Phenotypes of a mutant

• essential according to Kobayashi et al., but a mutant has been constructed and studied by Que and Helmann, 2000

The protein

Protein family

• bacterial solute-binding protein 9 family (according to Swiss-Prot)

Paralogous protein(s)

• ZnuA

Localization

• cell membrane (according to Swiss-Prot), extracellular lipoprotein (signal peptide) PubMed

Expression and Regulation

Operons

• Genes: mntA-mntB-mntC-mntD
  Description: PubMed

  Regulatory mechanism

  • MntR: repression, PubMed, in MntR regulon

  Regulation

  • repressed at high Mn(II) concentrations (MntR) PubMed

  Additional information

  • A ncRNA is predicted between 'mntA' and 'menC' PubMed

Biological materials

Mutant

• MGNA-A285 (ytgA::erm), available at the NBRP B. subtilis, Japan
• BKE30770 (ΔmntA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTTCTCCTCCTCTTTG, downstream forward: _UP4_TAAAGAAAAGAGGTGGAGGA
• BKK30770 (ΔmntA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTTCTCCTCCTCTTTG, downstream forward: _UP4_TAAAGAAAAGAGGTGGAGGA

Labs working on this gene/protein

• John Helmann, Cornell University, USA Homepage

References

Loading