You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
odhA
2-oxoglutarate dehydrogenase (E1 subunit)
Molecular weight
105.54 kDa
Product
2-oxoglutarate dehydrogenase (E1 subunit)
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,108,774 2,111,608
The protein
Catalyzed reaction/ biological activity
2-oxoglutarate + [dihydrolipoyllysine-residue succinyltransferase]-(R)-N6-lipoyl-L-lysine + H+ --> [dihydrolipoyllysine-residue succinyltransferase]-(R)-N6-(S8-succinyldihydrolipoyl)-L-lysine + CO2 (according to UniProt)Protein family
alpha-ketoglutarate dehydrogenase family (single member, according to UniProt)Modification
phosphorylated on Arg-66 and Arg-621 PubMed Structure
2JGD (from Escherichia coli, 38% identity, 55% similarity) PubMed Localization
cytoplasm (according to UniProt)Additional information
extensive information on the structure and enzymatic properties of 2-oxoglutarate dehydrogenase can be found at Proteopedia Expression and Regulation
Biological materials
Mutant
GP671 (spc), GP684 (cat), available in Jörg Stülke's labGP1274 Δ(odhA)::cat, available in Jörg Stülke's labGP1276 Δ(odhA-odhB)::cat, available in Jörg Stülke's labGP2183 Δ(odhA)::ermC, available in Jörg Stülke's lab PubMedGP2332 Δ(odhA-odhB)::kan, Cre-recombinase is integrated in sacA, available in Jörg Stülke's labGP2334 Δ(odhA-odhB)::lox72, Cre-recombinase is integrated in sacA, available in Jörg Stülke's labBKE19370 (odhA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGAATATTACCCCCAA, downstream forward: _UP4_AAAAACTAAGGGGGAAATGABKK19370 (odhA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGAATATTACCCCCAA, downstream forward: _UP4_AAAAACTAAGGGGGAAATGA LacZ fusion
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab References
Reviews
Loading
Original publications
Loading