yveA

similar to aspartate/ glutamate transporter

Locus: BSU_34470

Isoelectric point: 9.68

Molecular weight: 56.82 kDa

Protein length: 520 aa

Gene length: 1563 bp

Function: unknown

Product: similar to aspartate/ glutamate transporter

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → APC superfamily
• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of aspartate/ asparagine
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of asparagine/ aspartate
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,539,165 3,540,727

The protein

Protein family

• amino acid-polyamine-organocation (APC) superfamily (according to UniProt)

Paralogous protein(s)

• AimA

Structure

• 5OQT (YneM from E. coli, 28% identity) PubMed

Localization

• cell membrane (according to UniProt)

Additional information

• the protein has been annotated as aspartate transporter. It is, however, not implicated in aspartate uptake in exponentially growing cells PubMed

Expression and Regulation

Operons

• Genes: yveA
  Description: PubMed

  Sigma factors

  • SigG: sigma factor, PubMed, in SigG regulon

  Regulatory mechanism

  • DegU: activation, DegU-P, PubMed, in DegU regulon

  Regulation

  • expressed during sporulation in the forespore (SigG) PubMed

Biological materials

Mutant

• GP2385 ∆yveA::cat, available in Jörg Stülke's lab
• GP2795 ∆yveA::spec, available in Jörg Stülke's lab
• GP2822 ∆yveA::neo, available in Jörg Stülke's lab
• BKE34470 (yveA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCGCTTCCTCCTTTGAA, downstream forward: _UP4_TAAAGAAGCAAGAGGTTTTC
• BKK34470 (yveA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCGCTTCCTCCTTTGAA, downstream forward: _UP4_TAAAGAAGCAAGAGGTTTTC
• MDB43 (yveA::neo trpC2 pheA1 available in Erhard Bremer's and Jörg Stülke's labs PubMed
• MGNA-B615 (yveA::erm), available at the NBRP B. subtilis, Japan

References

Loading