efeB

elemental iron uptake system, heme peroxidase, converts ferrous iron (Fe(II) to ferric iron (FeIII)) for uptake by EfeO-EfeU, peroxide detoxification under microaerobic conditions

Locus: BSU_38260

Isoelectric point: 8.64

Molecular weight: 45.53 kDa

Protein length: 416 aa

Gene length: 1251 bp

Function: ferrous iron conversion

Product: heme peroxidase in elemental iron uptake

Essential: no

E.C.: 1.11.1.-

Synonyms: ipa-29d,ywbN

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Homeostasis → Acquisition of iron → Elemental iron transport system
• Metabolism → Additional metabolic pathways → Iron metabolism → Elemental iron transport system
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Lifestyles → Coping with stress → Resistance against oxidative and electrophile stress
• Groups of genes → Secreted proteins
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,926,682 3,927,932

The protein

Catalyzed reaction/ biological activity

• oxidizes ferrous iron to ferric iron for uptake by EfeO-EfeU PubMed
• eliminates reactive oxygen species that accumulate in the presence of ferrous iron PubMed
• peroxide detoxification under microaerobic conditions PubMed

Protein family

• DyP-type peroxidase family (single member, according to UniProt)

Cofactors

• protoheme IX PubMed

Effectors of protein activity

• activity is increased in the presence of EfeO due to the displacement of ferric iron PubMed

Structure

• 2Y4F (from E. coli, 38% identity)

Localization

• extracellular, secreted by the TatAY-TatCY complex PubMed
• TatAY-TatCY-dependent export of EfeB requires a functional WprA PubMed
• forms a membrane-bound complex with EfeU and EfeO for iron uptake PubMed
• attached to the membrane via EfeU PubMed

Expression and Regulation

Operons

• Genes: efeU-efeO-efeB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigM: sigma factor, PubMed, in SigM regulon
  • SigW: sigma factor, PubMed, in SigW regulon
  • SigX: sigma factor, in SigX regulon

  Regulatory mechanism

  • Fur: repression, PubMed, in Fur regulon

  Regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) (Fur) PubMed

• Genes: efeB-ywbO
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon
  • SigW: sigma factor, PubMed, in SigW regulon
  • SigX: sigma factor, in SigX regulon

  Regulation

  • induced upon iron starvation (Fur) PubMed

Biological materials

Mutant

• MGNA-B228 (ywbN::erm), available at the NBRP B. subtilis, Japan
• BKE38260 (efeB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGATGTTACAAAACTCCT, downstream forward: _UP4_TAAAAGAAGCCTTTACAGGC
• BKK38260 (efeB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGATGTTACAAAACTCCT, downstream forward: _UP4_TAAAAGAAGCCTTTACAGGC

Labs working on this gene/protein

• Jan Maarten van Dijl, Groningen, Netherlands

References

Reviews

Loading

Original publications

Loading