spoIIQ [2020-07-19 17:36:28]

component of the SpoIIIAH-SpoIIQ type III secretion system residing in the forespore membrane, required for anchoring of proteins on both sides of the sporulation septum, required for localization and stability of SpoIIE

Locus: BSU_36550

Isoelectric point: 4.47

Molecular weight: 30.96 kDa

Protein length: 283 aa

Gene length: 852 bp

Function: forespore encasement by the spore coat

Product: part of the transmembrane channel linking the mother cell and the forespore

Essential: no

Synonyms: ywnI

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,759,702 3,760,553

The protein

Catalyzed reaction/ biological activity

• required for forespore encasement by the spore coat PubMed
• required for the recruitment of SpoIIIAH to the sporulation septum on the mother cell side PubMed
• required for the proper localization and stability of SpoIIE PubMed

Structure

• 3UZO; 3TUF (the SpoIIQ-SpoIIIAH pore forming complex) PubMed

Localization

• membrane protein, forms a transmembrane channel linking the mother cell and the forespore (with SpoIIIAH) PubMed
• septal membranes on the forespore side PubMed
• proper localization requires SpoIIIAH, GerM and degradation of septal peptidoglycan by the cell wall hydrolases SpoIID and SpoIIP PubMed

Expression and Regulation

Operons

• Genes: spoIIQ
  Description: PubMed

  Sigma factors

  • SigF: sigma factor, PubMed, in SigF regulon

  Regulation

  • expressed early during sporulation in the forespore (SigF) PubMed

Biological materials

Mutant

• BKE36550 (spoIIQ::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGTTTCATCACCTCAGC, downstream forward: _UP4_TAATGAAGAAAACGTCTATC
• BKK36550 (spoIIQ::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGTTTCATCACCTCAGC, downstream forward: _UP4_TAATGAAGAAAACGTCTATC

References

Reviews

Loading

Original publications

Loading