lytE [2017-11-09 10:26:22]

cell wall hydrolase (major autolysin) for cell elongation and separation, D,L-endopeptidase-type autolysin

Locus: BSU09420

Isoelectric point: 10.71

Molecular weight: 37.16 kDa

Protein length: 343 aa

Gene length: 1029 bp

Function: major autolysin, cell elongation and separation

Product: cell wall hydrolase (major autolysin),endopeptidase-type autolysin

Essential: no

E.C.: 3.4.-.-

Synonyms: papQ,cwlF

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Autolytic activity required for peptidoglycan synthesis (cell elongation)
• Cellular processes → Cell envelope and cell division → Cell shape
• Cellular processes → Cell envelope and cell division → Cell wall degradation/ turnover → Autolysis
• Cellular processes → Cell envelope and cell division → Cell wall degradation/ turnover → Endopeptidases

Gene

Coordinates: 1,018,998 → 1,020,002

Phenotypes of a mutant

• a cwlO lytE mutant is not viable PubMed
• growth defect at high temperature PubMed
• inactivation of lytE strongly restores beta-lactam resistance in a sigM mutant by delaying cell lysis PubMed
• a lytE mutation is synthetically lethal with ftsE and ftsX mutation (due to a lack of autolysin activity) PubMed
• a lytE mutation increases the cell separation defect of a lytF mutant PubMed
• cells are thinner (reduced diameter) as compared to the wild type PubMed

The protein

Catalyzed reaction/ biological activity

• cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) PubMed

Protein family

• nlpC/p60 family (according to Swiss-Prot)

Paralogous protein(s)

• the C-terminal D,L-endopeptidase domains of LytE, LytF, CwlS, and CwlO exhibit strong sequence similarity

Domains

• contains three N-acetylglucosamine-polymer-binding LysM domains PubMed
• C-terminal D,L-endopeptidase domain PubMed

Effectors of protein activity

• activity requires functional MreB and MreBH PubMed

Structure

• 4XCM (from Thermus thermophilus, 34% identity) PubMed

Localization

• binds the cell wall PubMed
• localizes to cell septa, poles and lateral sidewall of the cell (via the N-terminal domain) PubMed
• localization to lateral cell wall depends on the interaction with MreBH PubMed

Expression and Regulation

Operons

• Genes: lytE
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigH: sigma factor, PubMed, in SigH regulon
  • SigI: sigma factor, PubMed, in SigI regulon

  Regulatory mechanism

  • WalR: activation, PubMed, in WalR regulon
  • Spo0A: repression, PubMed, in Spo0A regulon

  Regulation

  • expression is modulated in response to D,L-endopeptidase activity (increased two-fold to compensate for reduced activity in the absence of CwlO or FtsE-FtsX, decreased upon overexpression of LytE) (WalR) PubMed
  • induced at high temperature (SigI, WalR) PubMed

Biological materials

Mutant

• 1A790 ( lytE::cat), PubMed, available at BGSC
• 1A792 ( lytE::cat), PubMed, available at BGSC
• 1A1024 ( lytE::spec), PubMed, available at BGSC
• BKE09420 (lytE::erm, available in the BGSC and in Jörg Stülke's lab) PubMed
• BKE09420 (ΔlytE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG
• BKK09420 (ΔlytE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG

FLAG-tag construct

• GP2020 lytE-3xFLAG spec (based on pGP1331), available in Jörg Stülke's lab

References

Reviews

Loading

Original publications

Loading