swrD

swarming protein, increases flagellar power via the flagellar stators MotA and MotB

Locus: BSU_16299

Isoelectric point: 4.00

Molecular weight: 8.00 kDa

Protein length: 71 aa

Gene length: 216 bp

Function: swarming

Product: swarming protein

Essential: -

Synonyms: ylzI

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Exponential and early post-exponential lifestyles → Motility and chemotaxis → Signal transduction in motility and chemotaxis → Additional chemotaxis signal transduction and regulatory proteins
• Lifestyles → Exponential and early post-exponential lifestyles → Swarming

Gene

Coordinates: 1,701,016 1,701,231

Phenotypes of a mutant

• loss of swarming motility PubMed
• cells swim with reduced speed PubMed

Expression and Regulation

Operons

• Genes: ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliZ-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigD: sigma factor, PubMed, in SigD regulon

  Regulatory mechanism

  • Spo0A: repression, in Spo0A regulon
  • CodY: repression, in CodY regulon
  • DegU: regulation, in DegU regulon
  • SwrA: activation, in SwrA regulon

  Regulation

  • see fla-che operon

• Genes: flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliZ-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigD: sigma factor, PubMed, in SigD regulon

  Regulatory mechanism

  • Spo0A: repression, in Spo0A regulon
  • SwrA: activation, in SwrA regulon
  • CodY: repression, in CodY regulon
  • DegU: repression, in DegU regulon

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

Biological materials

Mutant

• BKE16299 (swrD::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAAACAGCGGAGAAGCG, downstream forward: _UP4_GATCAAGGAATAGAGGAACC
• BKK16299 (swrD::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAAACAGCGGAGAAGCG, downstream forward: _UP4_GATCAAGGAATAGAGGAACC

References

Reviews

Loading

Original Publications

Loading