You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
efp [2018-04-09 17:08:59]
elongation factor P, important for the
Translation of proteins containing three or more consecutive proline residues
Molecular weight
20.31 kDa
Product
elongation factor P
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,538,115 → 2,538,672
Phenotypes of a mutant
impaired swarming motility PubMedinactivation of efp reduces sporulation efficiency to 1% that of wild type cells PubMed The protein
Protein family
transpeptidase family (according to Swiss-Prot) elongation factor P family (according to Swiss-Prot)Modification
carries a 5-aminopentanol moiety at Lys-32, this modification is essential for activity PubMed Structure
1YBY (Efp from Clostridium thermocellum) Localization
cytoplasm (according to Swiss-Prot)Additional information
subject to Clp-dependent proteolysis upon glucose starvation PubMed Expression and Regulation
Biological materials
Mutant
MGNA-C464 (efp::erm), available at the NBRP B. subtilis, JapanBKE24450 (efp::erm, available in the BGSC and in Jörg Stülke's lab) PubMedBKE24450 (Δefp::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTAATGTCCTCCTAT, downstream forward: _UP4_TAGAAAGAAAAAAAGAAGTCBKK24450 (Δefp::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTAATGTCCTCCTAT, downstream forward: _UP4_TAGAAAGAAAAAAAGAAGTC References
Reviews
Loading
Original publications
Loading