dltE

D-alanine transfer from undecaprenol-phosphate to the poly(glycerophosphate) chain, alanylation of teichoic acid provides some resistance against positively charged antimicrobial peptides

Locus: BSU_38540

Isoelectric point: 5.09

Molecular weight: 28.12 kDa

Protein length: 252 aa

Gene length: 759 bp

Function: biosynthesis of teichoic acid

Product: D-alanine transfer from undecaprenol-phosphate to the poly(glycerophosphate) chain

Essential: no

Synonyms: ipa-1r

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Biosynthesis of teichoic acid
• Metabolism → Additional metabolic pathways → Biosynthesis of cell wall components → Biosynthesis of teichoic acid
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)

Gene

Coordinates: 3,956,492 3,957,250

Phenotypes of a mutant

• more sensitive to nisin PubMed

The protein

Protein family

• Short-chain dehydrogenases/reductases (SDR) family (according to UniProt)

Structure

• 5FF9 (28% identity) PubMed

Localization

• cytoplasm (according to UniProt)

Expression and Regulation

Operons

• Genes: ywzH-dltA-dltB-dltC-dltD-dltE
  Description: PubMed

  Sigma factors

  • SigD: sigma factor, PubMed, in SigD regulon
  • SigM: sigma factor, PubMed, in SigM regulon
  • SigX: sigma factor, PubMed, in SigX regulon
  • SigV: sigma factor, PubMed, in SigV regulon

  Regulatory mechanism

  • YvrHb: activation, PubMed, in YvrHb regulon
  • Spo0A: repression, PubMed, in Spo0A regulon
  • stringent response: negative regulation, in stringent response

  Regulation

  • expression is reduced in a SigV mutant PubMed
  • the mRNA is processed between ywzH and dltA by RNase Y, this requires the YmcA-YlbF-YaaT complex PubMed

Biological materials

Mutant

• BKE38540 (dltE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGGATGTAACACCTCTT, downstream forward: _UP4_TAATTTCTCCTGCTTTTTTC
• BKK38540 (dltE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGGATGTAACACCTCTT, downstream forward: _UP4_TAATTTCTCCTGCTTTTTTC

References

Loading