cheY [2019-02-28 14:49:57]

two-component response regulator, modulation of flagellar switch bias, CheY-phosphate induces a switch from clockwise to counter-clockwise rotation

Locus: BSU16330

Isoelectric point: 4.75

Molecular weight: 13.17 kDa

Protein length: 120 aa

Gene length: 363 bp

Function: modulation of flagellar switch bias

Product: two-component response regulator

Essential: no

Synonyms: cheB

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Two-component system response regulators
• Lifestyles → Exponential and early post-exponential lifestyles → Motility and chemotaxis → Signal transduction in motility and chemotaxis → Soluble signalling proteins
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Other proteins required for efficient pellicle biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Swarming
• Groups of genes → Phosphoproteins → Phosphorylation on an Asp residue

Gene

Coordinates: 1,703,834 1,704,196

Phenotypes of a mutant

• not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation PubMed

The protein

Paralogous protein(s)

• YneI

Modification

• phosphorylated by CheA on an Asp residue
• dephosphorylated by CheC PubMed

Structure

• 1TMY (CheY from Thermotoga maritima)

Localization

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliZ-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigD: sigma factor, PubMed, in SigD regulon

  Regulatory mechanism

  • Spo0A: repression, in Spo0A regulon
  • CodY: repression, in CodY regulon
  • DegU: regulation, in DegU regulon
  • SwrA: activation, in SwrA regulon

  Regulation

  • see fla-che operon

• Genes: flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliZ-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigD: sigma factor, PubMed, in SigD regulon

  Regulatory mechanism

  • Spo0A: repression, in Spo0A regulon
  • SwrA: activation, in SwrA regulon
  • CodY: repression, in CodY regulon
  • DegU: repression, in DegU regulon

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

Biological materials

Mutant

• 1A798 ( cheY::cat), PubMed, available at BGSC
• DS6870 (marker-less in NCIB3610) PubMed
• BKE16330 (cheY::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATCTATCTCTCTCCTT, downstream forward: _UP4_TTAAATTAAAGGGTGTACGA
• BKK16330 (cheY::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATCTATCTCTCTCCTT, downstream forward: _UP4_TTAAATTAAAGGGTGTACGA

References

Reviews

Loading

Original Publications

Loading