fliY [2019-02-06 18:14:56]

flagellar C ring protein

Locus: BSU16320

Isoelectric point: 4.12

Molecular weight: 40.89 kDa

Protein length: 378 aa

Gene length: 1137 bp

Function: movement and chemotaxis

Product: flagellar C ring protein

Essential: no

Synonyms: cheD

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein phosphatases
• Lifestyles → Exponential and early post-exponential lifestyles → Motility and chemotaxis → Signal transduction in motility and chemotaxis → Additional chemotaxis signal transduction and regulatory proteins
• Lifestyles → Exponential and early post-exponential lifestyles → Motility and chemotaxis → Flagellar proteins
• Groups of genes → Membrane proteins
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue

Gene

Coordinates: 1,702,672 1,703,808

Phenotypes of a mutant

• A fliY null mutant has no flagella PubMed.

The protein

Protein family

• fliN/mopA/spaO family (according to Swiss-Prot) cheC family

Paralogous protein(s)

• CheC, FliM

Modification

• phosphorylated on Arg-251 PubMed

Localization

• cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliZ-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigD: sigma factor, PubMed, in SigD regulon

  Regulatory mechanism

  • Spo0A: repression, in Spo0A regulon
  • CodY: repression, in CodY regulon
  • DegU: regulation, in DegU regulon
  • SwrA: activation, in SwrA regulon

  Regulation

  • see fla-che operon

• Genes: flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliZ-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigD: sigma factor, PubMed, in SigD regulon

  Regulatory mechanism

  • Spo0A: repression, in Spo0A regulon
  • SwrA: activation, in SwrA regulon
  • CodY: repression, in CodY regulon
  • DegU: repression, in DegU regulon

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

Biological materials

Mutant

• BKE16320 (fliY::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TATTATTCTCCATCTTGTTC, downstream forward: _UP4_TAACGAAACACAAGGAGAGA
• BKK16320 (fliY::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TATTATTCTCCATCTTGTTC, downstream forward: _UP4_TAACGAAACACAAGGAGAGA

References

Reviews

Loading

Original Publications

Loading