spx

transcriptional regulator Spx, involved in regulation of many genes, important for the prevention of protein aggregation during severe heat stress, required for protection against paraquat stress

Locus: BSU_11500

Isoelectric point: 7.91

Molecular weight: 15.39 kDa

Protein length: 131 aa

Gene length: 396 bp

Function: negative and positive regulator of many genes

Product: transcriptional regulator Spx

Essential: no

Synonyms: yjbD

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other
• Lifestyles → Coping with stress → General stress proteins (controlled by SigB)
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Lifestyles → Coping with stress → Resistance against oxidative and electrophile stress
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue

Gene

Coordinates: 1,227,697 1,228,092

Phenotypes of a mutant

• Loss of up-regulation of the methionine sulfoxide reductase (msrA-msrB) operon in response to thiol specific oxidative stress, also loss of trxA and trxB upregulation in response to thiol specific oxidative stress.

The protein

Catalyzed reaction/ biological activity

• transcriptional regulator of many genes in response to thiol specific oxidative stress (transcription activator of trxA and trxB)
• in addition, Spx inhibits transcription by binding to the C-terminal domain of the alpha subunit of RNAP (RpoA), disrupting complex formation between RNAP and certain transcriptional activator proteins like ResD and ComA
• in response to thiol specific oxidative stress, Spx can also activate transcription, making it a general regulator that exerts both positive and negative control over transcription initiation
• involved in competence regulation PubMed
• inhibits expression of translation-related genes during heat stress PubMed

Protein family

• ArsC family (with MgsR and YusI, according to UniProt)

Paralogous protein(s)

• MgsR

Domains

• CXXC (10-13): Acts as a disulfide switch for the redox-sensitive transcriptional regulation of genes that function in thiol homeostasis.

Modification

• Cysteine oxidation of CXXC motif
• phosphorylation on R14, R91, R100, R112 by McsB, dephosphosphorylation by YwlE PubMed

Structure

• 1Z3E complex with C-terminal domain of RpoA PubMed
• 6GHB (complexed with oxidized Geobacillus kaustophilus YjbH) PubMed
• 6GHO (complexed with Geobacillus kaustophilus YjbH) PubMed

Localization

• cytoplasm (according to UniProt)

Expression and Regulation

Operons

• Genes: spx
  Description: PubMed

  Sigma factors

  • SigW: sigma factor, four promoters upstream of YjbC, in SigW regulon
  • SigB: sigma factor, four promoters upstream of YjbC, in SigB regulon
  • SigX: sigma factor, four promoters upstream of YjbC PubMed, in SigX regulon
  • SigM: sigma factor, four promoters upstream of YjbC PubMed, in SigM regulon
  • SigA: sigma factor, four promoters upstream of YjbC, in SigA regulon

  Regulatory mechanism

  • PerR: repression, PubMed, in PerR regulon

  Regulation

  • induced by stress (SigB) PubMed

• Genes: yjbC-spx
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon
  • SigW: sigma factor, in SigW regulon
  • SigB: sigma factor, in SigB regulon
  • SigX: sigma factor, PubMed, in SigX regulon

  Regulatory mechanism

  • PerR: repression, PubMed, in PerR regulon

  Regulation

  • induced by stress (SigB) PubMed

Additional information

• post-translational control by ClpX-ClpP: Spx naturally contains a C-terminal sequence that resembles the SsrA tag and targets the protein for degradation. PubMed

Biological materials

Mutant

• MGNA-B151 (yjbD::erm), available at the NBRP B. subtilis, Japan
• GPUG3 (spc), available in Ulf Gerths and Jörg Stülke's labs
• GP1788 (spc), available in Jörg Stülke's lab
• ORB6781 (spc), ORB6876 (tet), available in Zuber lab, also available in Jörg Stülke's lab
• 1A917 ( spx::spec), PubMed, available at BGSC
• 1A916 ( spx::tet), PubMed, available at BGSC
• BKE11500 (spx::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCATCTTCACTCCTCTA, downstream forward: _UP4_TAATAGATCGTATCATCAAA
• BKK11500 (spx::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCATCTTCACTCCTCTA, downstream forward: _UP4_TAATAGATCGTATCATCAAA

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Labs working on this gene/protein

• Peter Zuber, Oregon Health and Science University, USA, Homepage
• Richard Brennan, Houston, Texas, USA Homepage

References

Reviews

Loading

The Spx regulon

Loading

Structural analysis of Spx

Loading

Original Publications

Loading