radC [2019-09-20 09:48:22]

probable DNA repair protein

Locus: BSU_28040

Isoelectric point: 7.83

Molecular weight: 26.00 kDa

Protein length: 231 aa

Gene length: 696 bp

Function: DNA repair

Product: probable DNA repair protein

Essential: no

Synonyms: ysxA

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Genetics → DNA repair/ recombination
• Information processing → Genetics → DNA repair/ recombination → Other proteins
• Information processing → Genetics → Genetic competence
• Lifestyles → Exponential and early post-exponential lifestyles → Genetic competence
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue

Gene

Coordinates: 2,861,840 2,862,535

The protein

Protein family

• UPF0758 family (single member, according to UniProt)

Modification

• phosphorylated on Arg-59 PubMed

Structure

• 2QLC (C-terminal domain of Chlorobium tepidum RadC, 46% identity)

Localization

• cytoplasm (Homogeneous) PubMed

Expression and Regulation

Operons

• Genes: maf-radC-mreB-mreC-mreD-minC-minD
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, promoter p2 within Maf PubMed, in SigM regulon
  • SigA: sigma factor, promoter p1, upstream of Maf PubMed, in SigA regulon

  Regulatory mechanism

  • ComK: activation, PubMed, in ComK regulon

  Regulation

  • constitutively expressed PubMed

Biological materials

Mutant

• MGNA-B011 (ysxA::erm), available at the NBRP B. subtilis, Japan
• BKE28040 (radC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAGCACTCCTTTTCTTTCC, downstream forward: _UP4_TAACACTTTTTTTTTCGTCG
• BKK28040 (radC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAGCACTCCTTTTCTTTCC, downstream forward: _UP4_TAACACTTTTTTTTTCGTCG

References

Loading