SubtiBank SubtiBank
disA [2019-06-04 17:35:20]
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

disA [2019-06-04 17:35:20]

DNA integrity scanning protein, diadenylate cyclase, delays sporulation in the case of chromosome damage, the DisA-dependent checkpoint arrests DNA replication during B. subtilis spore outgrowth until the germinating spores genome is free of damage
Locus
BSU00880
Isoelectric point
5.57
Molecular weight
40.58 kDa
Protein length
360 aa Sequence Blast
Gene length
1083 bp Sequence Blast
Function
control of sporulation initiation
Product
DNA integrity scanning protein, has diadenylate cyclase activity
Essential
no
E.C.
2.7.7.85
Synonyms
yacK

Genomic Context

      
Loading

Categories containing this gene/protein

Gene

Coordinates
107,476 108,558

Phenotypes of a mutant

  • a cdaA disA double mutant or cdaA cdaS disA triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) PubMed
  • reduced spore survival after infrared exposure PubMed
  • altered morphology on MSgg medium PubMed
  • plant root colonization defect PubMed
  • The protein

    Catalyzed reaction/ biological activity

  • synthesis of c-di-AMP from two molecules of ATP PubMed
  • binds RecA to inhibit its activity PubMed
  • Protein family

  • disA family (according to Swiss-Prot)
  • Domains

  • contains a DAC domain for the synthesis of c-di-AMP PubMed
  • Cofactors

  • Mn2+ PubMed
  • Effectors of protein activity

  • RadA is an inhibitor of DisA activity PubMed
  • the presence of potassium results in enhanced activity PubMed
  • Structure

    Localization

  • see a video showing the movement of DisA in the cell (in real time) PubMed
  • forms discrete globular foci in germinating spres that colocalize with the nucleoid PubMed
  • forms rapidly moving focus that pausesat RecA-mediated recombination intermediates upon induction of DNA damage during spore development PubMed
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation PubMed
  • Expression and Regulation

    Operons

    Description

    Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon
  • SigA: sigma factor, PubMed, in SigA regulon
  • SigB: sigma factor, PubMed PubMed, in SigB regulon
  • SigF: sigma factor, PubMed, in SigF regulon
  • Regulatory mechanism

  • CtsR: repression, PubMed, in CtsR regulon
  • Spx: activation, PubMed, in Spx regulon
  • Regulation

  • expressed during germination and spore outgrowth PubMed
  • induction during diamide stress (Spx) PubMed
  • view in new tab

    Genes
    Description

    Regulation

  • expressed during germination and spore outgrowth PubMed
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B932 (disA::erm), available at the NBRP B. subtilis, Japan
  • GP2142 (ΔdisA::tet), available in Jörg Stülke's lab
  • BKG2 (radA-disA::spc), available in Jörg Stülke's lab
  • 1A939 ( disA::tet), PubMed, available at BGSC
  • GP2222 (cdaA::cat cdaS::ermC disA::tet), available in Jörg Stülke's lab, the mutant is only viable on minimal medium at low potassium concentration PubMed
  • BKE00880 (disA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTA
  • BKK00880 (disA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTA
  • GP2715 (ΔdisA::spc), available in Jörg Stülke's lab
  • GP2752 (ΔdisA::cat), available in Jörg Stülke's lab
  • GP2782 (ΔdisA::kan), available in Jörg Stülke's lab
  • Expression vectors

  • IPTG inducible expression of His-disA in E. coli: pGP2563 (in pET19b), available in Jörg Stülke's lab
  • Two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Fabian Commichau's lab
  • References

    Reviews

    Loading

    Original publications

    Loading