You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
disA [2019-02-19 17:44:33]
DNA integrity scanning protein, diadenylate cyclase, delays
sporulation in the case of chromosome damage, the DisA-dependent checkpoint arrests
DNA replication during
B. subtilis spore outgrowth until the germinating spores genome is free of damage
Molecular weight
40.58 kDa
Product
DNA integrity scanning protein, has diadenylate cyclase activity
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
107,476 108,558
Phenotypes of a mutant
a cdaA disA double mutant or cdaA cdaS disA triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) PubMedreduced spore survival after infrared exposure PubMedaltered morphology on MSgg medium PubMedplant root colonization defect PubMed The protein
Catalyzed reaction/ biological activity
synthesis of c-di-AMP from two molecules of ATP PubMed Protein family
disA family (according to Swiss-Prot)Domains
Cofactors
Effectors of protein activity
RadA is an inhibitor of DisA activity PubMedthe presence of potassium results in enhanced activity PubMed Structure
Localization
see a video showing the movement of DisA in the cell (in real time) PubMedforms discrete globular foci in germinating spres that colocalize with the nucleoid PubMed Additional information
subject to Clp-dependent proteolysis upon glucose starvation PubMed Expression and Regulation
Operons
Sigma factors
Regulatory mechanism
Regulation
expressed during germination and spore outgrowth PubMedinduction during diamide stress (Spx) PubMed view in new tabBiological materials
Mutant
MGNA-B932 (disA::erm), available at the NBRP B. subtilis, JapanGP2142 (disA::tet), available in Jrg Stlke's labBKG2 (radA-disA::spc), available in Jrg Stlke's lab1A939 ( disA::tet), PubMed, available at BGSCGP2222 (cdaA::cat cdaS::ermC disA::tet), available in Jrg Stlke's lab, the mutant is only viable on minimal medium at low potassium concentration PubMedBKE00880 (disA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTABKK00880 (disA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTAGP2715 (disA::spc), available in Jrg Stlke's labGP2752 (disA::cat), available in Jrg Stlke's lab Expression vectors
IPTG inducible expression of His-disA in E. coli: pGP2563 (in pET19b), available in Jrg Stlke's lab Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Fabian Commichau's lab References
Reviews
Loading
Original publications
Loading