You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yloU [2019-07-01 10:30:45]
similar to alkaline-shock protein
Molecular weight
13.05 kDa
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,656,064 1,656,426
The protein
Protein family
asp23 family (according to Swiss-Prot)Paralogous protein(s)
Expression and Regulation
Biological materials
Mutant
MGNA-B375 (yloU::erm), available at the NBRP B. subtilis, JapanGP1465 (yloU-cat ), available in Jörg Stülke's lab PubMedGP1467 (yloU-fakA-cat ), available in Jörg Stülke's lab PubMedBKE15830 (yloU::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACACTAGTTCCTCCTTCGA, downstream forward: _UP4_AACCCGTAGTTAGGAGGAGTBKK15830 (yloU::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACACTAGTTCCTCCTTCGA, downstream forward: _UP4_AACCCGTAGTTAGGAGGAGT Expression vectors
GP1476 (chromosomal yloU-Strep fusion, aphA3), purification from B. subtilis, for SPINE, available in Jörg Stülke's labpGP1330 (N-terminal Strep-tag, purification from E. coli, in pGP172), available in Jörg Stülke's labpGP1324 (N-terminal His-tag, in pWH844), available in Jörg Stülke's lab GFP fusion
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab References
Loading