sspE [2019-03-01 18:54:15]

small acid-soluble spore protein (major gamma-type SASP)

Locus: BSU08660

Isoelectric point: 8.94

Molecular weight: 9.13 kDa

Protein length: 84 aa

Gene length: 255 bp

Function: protection of spore DNA

Product: small acid-soluble spore protein (major gamma-type SASP)

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Sporulation → Sporulation proteins → Small acid-soluble spore proteins
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue

Gene

Coordinates: 937,900 938,154

The protein

Protein family

• gamma-type SASP family (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: fabL-sspE
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigG: sigma factor, PubMed, in SigG regulon

  Regulatory mechanism

  • SpoVT: repression, in SpoVT regulon
  • YfhP: repression, in YfhP regulon

  Regulation

  • repressed by casamino acids PubMed

• Genes: mutY-fabL-sspE
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigG: sigma factor, PubMed, in SigG regulon

  Regulatory mechanism

  • YfhP: repression, in YfhP regulon

  Regulation

  • expression is constitutive throughout growth PubMed

Biological materials

Mutant

• MGNA-C365 (sspE::erm), available at the NBRP B. subtilis, Japan
• 1S112 (no resistance), PubMed, available at BGSC
• 1S113 (no resistance), PubMed, available at BGSC
• BKE08660 (sspE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGTTATCACCTCCACGG, downstream forward: _UP4_TAATCACTGAAACAGAAAAA
• BKK08660 (sspE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTGTTATCACCTCCACGG, downstream forward: _UP4_TAATCACTGAAACAGAAAAA

References

Loading