recG [2019-08-15 11:07:01]

ATP-dependent DNA helicase, branch migration translocase, required for DNA repair and chromosomal segregation

Locus: BSU_15870

Isoelectric point: 7.09

Molecular weight: 77.96 kDa

Protein length: 682 aa

Gene length: 2049 bp

Function: DNA repair and chromosomal segregation

Product: ATP-dependent DNA helicase, branch migration translocase

Essential: no

Synonyms: ylpB

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Genetics → DNA repair/ recombination
• Information processing → Genetics → DNA repair/ recombination → Other proteins

Gene

Coordinates: 1,659,810 1,661,858

Phenotypes of a mutant

• a recD2 recG double mutant is not viable PubMed
• a recG radA double mutant is non-transformable with chromosomal DNA PubMed

The protein

Catalyzed reaction/ biological activity

• binds and unwinds Holliday junction DNA PubMed
• ATP + H₂O --> ADP + H⁺ + phosphate (according to UniProt)

Protein family

• helicase family (according to UniProt)

Paralogous protein(s)

• Mfd

Structure

• 1GM5 (from Thermotoga maritima, 43% identity, 62% similarity)

Expression and Regulation

Operons

• Genes: sdaAB-sdaAA-recG
  Description: PubMed

Biological materials

Mutant

• 1A897 (no resistance), PubMed, available at BGSC
• BKE15870 (recG::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CCCAATACCCTTAATGTTAG, downstream forward: _UP4_TGAGTATCAGAAGTTTTTGG
• BKK15870 (recG::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CCCAATACCCTTAATGTTAG, downstream forward: _UP4_TGAGTATCAGAAGTTTTTGG

References

Loading