ccpN [2019-09-18 11:42:38]

transcriptional repressor (CcpN family) of gluconeogenetic genes and of sr1. repression in the presence of glucose

locus: BSU_25250

pI: 7.22

mw: 23.72 kDa

protein length: 212 aa

gene length: 639 bp

function: repressor of genes involved in gluconeogenesis ([gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB], [gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]) and of [gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]

product: transcriptional regulator (CcpN family)

essential: no

synonyms: yqzB

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]

Gene

Coordinates: 2,604,959 2,605,597

Phenotypes of a mutant

• Impaired growth on glucose due to re-routing of carbon from glycolysis to the pentose phosphate pathway [Pubmed|18586936]

The protein

Catalyzed reaction/ biological activity

• transcription repression of the ''[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]'', ''[gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]'', and ''[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]'' genes in the presence of glucose [Pubmed|2548995]

Protein family

• [SW|CcpN family]

[SW|Domains]

• HTH deoR-type domain (aa 6-70) (according to UniProt)
• 2 [SW|CBS domain]s (aa 83-139, aa 148-211) (according to UniProt)

Effectors of protein activity

• [protein|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|YqfL] (negative effector of CcpN activity) [Pubmed|15720552]
• ATP enhances CcpN-dependent repression, ADP counteracts the repressing activity of CcpN [Pubmed|18511073]

Structure

• [PDB|3FV6] (the [SW|CBS domain]s, aa 63 ... 212)

additional information

• information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000231 PRODORIC2 database]

Expression and Regulation

Operons

• genes: [gene|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]-[gene|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|yqfL]
  description: [Pubmed|15720552]

  regulation

  • constitutive [Pubmed|15720552]

  additional information

  • the intracellular concentration of CcpN is about 4 myM (according to [PubMed|20408793]).

Biological materials

Mutant

• MGNA-C493 (yqzB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2491 NBRP B. subtilis, Japan]
• DB104 ''ccpN''::cat, available in [SW|Sabine Brantl]'s lab
• GP1128 ''ccpN''::cat, available in [SW|Jörg Stülke]'s lab
• BKE25250 ([gene|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCACCTTTTCACTTCATA, downstream forward: _UP4_TAAGATTGCAAACTAACGGG
• BKK25250 ([gene|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCACCTTTTCACTTCATA, downstream forward: _UP4_TAAGATTGCAAACTAACGGG

Expression vectors

• pGP2923 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

Antibody

• available in [SW|Sabine Brantl]'s lab

labs

• [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
• [SW|Sabine Brantl], Bacterial Genetics, Friedrich-Schiller-University of Jena, Germany [http://www.uni-jena.de/AG_Bakteriengenetik_(_Doz__Dr__Sabine_Brantl_).html homepage]
• [SW|Uwe Sauer], ETH Zrich, Switzerland [http://www.imsb.ethz.ch/researchgroup/sauer homepage]

References

Reviews

• 20408793

Original Publications

• 15720552,16164558,17011578,18511073,18586936,19726675,19732150,22190493,23280112