dacC

penicillin-binding protein 4A, D-alanyl-D-alanine carboxypeptidase

Locus: BSU_18350

Isoelectric point: 5.41

Molecular weight: 52.72 kDa

Protein length: 491 aa

Gene length: 1476 bp

Function: carboxypeptidase

Product: penicillin-binding protein 4A, D-alanyl-D-alanine carboxypeptidase

Essential: no

Synonyms: pbp

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Penicillin-binding proteins
• Groups of genes → Secreted proteins

Gene

Coordinates: 1,998,340 1,999,815

The protein

Catalyzed reaction/ biological activity

• cleavage ofD-Ala-D-Ala interpeptide bridges in peptidoglycan PubMed
• Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)

Protein family

• peptidase S13 family (single member, according to UniProt)

Structure

• 1W5D PubMed
• 2J9P (complex with a peptidoglycan mimetic peptide) PubMed

Localization

• during vegetative growth: distinct foci and bands at cell periphery PubMed
• secreted, may be anchored in the membrane via a C-terminal amphiphatic alpha helix PubMed

Expression and Regulation

Operons

• Genes: galM-dacC
  Description: PubMed

  Sigma factors

  • SigH: sigma factor, PubMed, in SigH regulon
  • SigB: sigma factor, PubMed, in SigB regulon

Biological materials

Mutant

• MGNA-B075 (dacC::erm), available at the NBRP B. subtilis, Japan
• BKE18350 (dacC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTAATTTCCCCGCCTCTC, downstream forward: _UP4_TAATAGCGGGAGACCTGTTT
• BKK18350 (dacC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTAATTTCCCCGCCTCTC, downstream forward: _UP4_TAATAGCGGGAGACCTGTTT

GFP fusion

• 3102 trpC2 (amyE::P_xyl-gfp-dacC1-1473 spc) PubMed, available in Dirk Jan Scheffers' lab and in the BGSC
• 3104 trpC2 dacC::pSG5044 (cat P_xyl-gfpa-dacC1-615) PubMed, available in Dirk Jan Scheffers' lab and in the BGSC

References

Reviews

Loading

Original publications

Loading