frlM [2018-10-26 13:12:19]

aminosugar ABC transporter (permease)

Locus: BSU32580

Isoelectric point: 7.00

Molecular weight: 34.00 kDa

Protein length: 300 aa

Gene length: 900 bp

Function: uptake of sugar amines

Product: aminosugar ABC transporter (permease)

Essential: no

Synonyms: yurM

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of carbon sources
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of amino sugars
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of nitrogen sources other than amino acids → Utilization of amino sugars
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,347,919 → 3,348,821

The protein

Protein family

• MalFG subfamily (according to Swiss-Prot)

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: frlB-frlO-frlN-frlM-frlD-yurJ
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CodY: repression, PubMed, PubMed, in CodY regulon
  • FrlR: repression, PubMed, in FrlR regulon
  • YlxR: regulation, PubMed, in YlxR regulon

  Regulation

  • FrlB: repressed during growth in the presence of branched chain amino acids (CodY) PubMed
  • induced in the absence of YlxR PubMed

  Additional information

  • the frlB-frlO-frlN-frlM-frlD-yurJ operon is strongly downregulated in a cshA mutant PubMed

Biological materials

Mutant

• MGNA-A559 (yurM::erm), available at the NBRP B. subtilis, Japan
• BKE32580 (ΔfrlM::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TGTCTTCTTCTGAGGCAGCA, downstream forward: _UP4_GTAAAAGGATAAAGGAGGAA
• BKK32580 (ΔfrlM::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TGTCTTCTTCTGAGGCAGCA, downstream forward: _UP4_GTAAAAGGATAAAGGAGGAA

References

Loading