sfp/1

4-phosphopantetheinyl transferase (surfactin synthetase-activating enzyme), required for production of surfactin, plipastatin and bacillaene, inactive pseudogene in strain 168

locus: BSU_03569

pI: 0.00

mw: 0.00 kDa

protein length: 55 aa

gene length: 168 bp

function: phosphopantetheinylates a serine residue in each of the seven peptidyl carrier protein domains of the first three subunits of surfactin synthetase (SrfAA-SrfAB-SrfAC) and AcpK

product: 4-phosphopantetheinyl transferase

essential: no

synonyms: sfp

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
• [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
• [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
• [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]

Gene

Coordinates: 407,460 407,627

Phenotypes of a mutant

• No swarming motility on B medium. [Pubmed|19202088]

The protein

Catalyzed reaction/ biological activity

• CoA + apo-[peptidyl-carrier protein] = adenosine 3',5'-bisphosphate + holo-[peptidyl-carrier protein] (according to Swiss-Prot)

Protein family

• Gsp/sfp/hetI/acpT family (according to Swiss-Prot)

Biological materials

Mutant

• BKE03569 ([gene|1C4F076D54F5A07AC351D722A403F249ED097555|sfp/1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03569 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGGTGCAGGCGCACTGAAA, downstream forward: _UP4_ACAATGGTCTCGTACGAAGA
• BKK03569 ([gene|1C4F076D54F5A07AC351D722A403F249ED097555|sfp/1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03569 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGGTGCAGGCGCACTGAAA, downstream forward: _UP4_ACAATGGTCTCGTACGAAGA

labs

• [SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]

References

Reviews

• 20735481

Original publications

• 15955059,19202088,2848009,11489886,15065855,10581256,15066026,11867633,19202088,19749039,20094656,9484229,20148996,21278284,21466506,22773650,24826903,25002419