ywaD

double-zinc aminopeptidase

locus: BSU_38470

pI: 6.64

mw: 49.29 kDa

protein length: 455 aa

gene length: 1368 bp

function: unknown

product: double-zinc aminopeptidase

essential: no

synonyms: ipa-8r

Genomic Context

categories

• [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
• [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]

Gene

Coordinates: 3,948,555 3,949,922

The protein

Catalyzed reaction/ biological activity

• Release of N-terminal Arg and Lys from oligopeptides when P1' is not Pro. Also acts on arylamides of Arg and Lys (according to UniProt)
• Release of an N-terminal amino acid, preferentially leucine, but not glutamic or aspartic acids (according to UniProt)

Protein family

• peptidase M28 family (single member, according to UniProt)

Structure

• [PDB|6HC6]
• [PDB|6HC7]

[SW|Localization]

• extracellular (signal peptide) [Pubmed|18957862]

Expression and Regulation

Operons

• genes: [gene|162B960244B0E1334F9E99E7E0F050D3312830E5|ywaD]
  description: [Pubmed|9353933]

Biological materials

Mutant

• MGNA-B678 (ywaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1677 NBRP B. subtilis, Japan]
• BKE38470 ([gene|162B960244B0E1334F9E99E7E0F050D3312830E5|ywaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAAATAAACCTCCCC, downstream forward: _UP4_TAAAAAAAGACGGCACTTGG
• BKK38470 ([gene|162B960244B0E1334F9E99E7E0F050D3312830E5|ywaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAAATAAACCTCCCC, downstream forward: _UP4_TAAAAAAAGACGGCACTTGG

References

• 15668014,23426795,18957862,23787698,24633010,26898926,28257579