sfp/2

4-phosphopantetheinyl transferase (surfactin synthetase-activating enzyme), inactive pseudogene in strain 168

Locus: BSU_03570

Isoelectric point: 0.00

Molecular weight: 0.00 kDa

Protein length: 165 aa

Gene length: 498 bp

Function: phosphopantetheinylates a serine residue in each of the seven peptidyl carrier protein domains of the first three subunits of surfactin synthetase (SrfAA-SrfAB-SrfAC) and AcpK

Product: 4-phosphopantetheinyl transferase

Essential: no

Synonyms: sfp

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Additional metabolic pathways → Miscellaneous metabolic pathways → Biosynthesis of antibacterial compounds
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Other proteins required for biofilm formation
• Lifestyles → Coping with stress → Biosynthesis of antibacterial compounds
• Groups of genes → Pseudogenes

Gene

Coordinates: 407,638 408,135

Phenotypes of a mutant

• No swarming motility on B medium. PubMed

The protein

Catalyzed reaction/ biological activity

• CoA + apo-[peptidyl-carrier protein] = adenosine 3',5'-bisphosphate + holo-[peptidyl-carrier protein] (according to Swiss-Prot)

Protein family

• P-Pant transferase superfamily (with AcpS, according to UniProt)

Structure

• 4MRT PubMed

Biological materials

Mutant

• BKE03570 (sfp/2::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTAGATCCTCCGTCTG, downstream forward: _UP4_ATCGCTTCCGCTTGATTCCT
• BKK03570 (sfp/2::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTAGATCCTCCGTCTG, downstream forward: _UP4_ATCGCTTCCGCTTGATTCCT

Labs working on this gene/protein

• Mohamed Marahiel, Marburg University, Germany homepage

References

Reviews

Loading

Original publications

Loading