SubtiBank SubtiBank
ktrC [2020-07-01 16:47:09]
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

ktrC [2020-07-01 16:47:09]

glutamate-controlled potassium channel KtrC-KtrD, peripheric membrane component
Locus
BSU_14510
Isoelectric point
5.63
Molecular weight
24.20 kDa
Protein length
221 aa Sequence Blast
Gene length
666 bp Sequence Blast
Function
potassium uptake
Product
glutamate-controlled potassium channel KtrC-KtrD, peripheric membrane component
Essential
no
Synonyms
ylxV,yzaC,ykqB

Genomic Context

      
Loading

Categories containing this gene/protein

Gene

Coordinates
1,520,531 1,521,196

The protein

Protein family

  • KtrA potassium transport family (with KtrA, according to UniProt)
  • Paralogous protein(s)

    Kinetic information

  • the KtrC-KtrD channel has a low affinity for potassium, this is determined by KtrD PubMed
  • the affinity of KtrC-KtrD for potassium is strongly increased in the presence of glutamate (from 0.278 mM to 0.17 mM) PubMed
  • Domains

  • contains a RCK_N domain at the N-terminus (aa 4-126)(according to UniProt)
  • contains a c-di-AMP-binding RCK_C domain at the C-terminus (aa 135-219) (according to UniProt) PubMed
  • Effectors of protein activity

  • binds ADP and ATP PubMed
  • the protein binds c-di-AMP, KD = 30 nM, this results in inhibition of potassium uptake PubMed
  • the affinity of KtrC-KtrD for potassium is strongly increased in the presence of glutamate PubMed
  • Structure

  • 4J7C (the KtrA-KtrB complex, 56% identity) PubMed
  • 6I8V (KtrC in complex with ATP) PubMed
  • 4XTT (the S. aureus KtrA RCK_C domain in complex with c-di-AMP, 57% identity) PubMed
  • Localization

  • peripheral membrane protein PubMed
  • Expression and Regulation

    Operons

    Genes
    Description

    Regulation

  • constitutively expressed PubMed
  • view in new tab

    Description

    Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • Regulatory mechanism

  • Spo0A: activation, PubMed, in Spo0A regulon
  • Regulation

  • constitutively expressed PubMed
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A904 (ykqB::erm), available at the NBRP B. subtilis, Japan
  • GHB6 (ktrC::spec), PubMed (available in Erhard Bremer's and Jörg Stülke's) labs, available at BGSC as 1A955
  • GP2264 (ΔktrC::aphA3), available in Jörg Stülke's lab PubMed
  • GP2048 (ΔktrC::cat), available in Jörg Stülke's lab PubMed
  • GP2079 (ΔktrC::tet), available in Jörg Stülke's lab PubMed
  • GP2771 (ΔktrC::spec), available in Jörg Stülke's lab
  • GP2083 (ktrA-ktrB::aphA3 ktrC::tet), available in Jörg Stülke's lab PubMed
  • BKE14510 (ktrC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC
  • BKK14510 (ktrC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC
  • Expression vector

  • pGP2994: expression of Strep-KtrC in B. subtilis suitable for SPINE (based on pGP380), available in Jörg Stülke's lab
  • pGP2995: expression of KtrC-Strep in B. subtilis suitable for SPINE (based on pGP382), available in Jörg Stülke's lab
  • Expression vectors

  • pGP2907 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab
  • Labs working on this gene/protein

  • Erhard Bremer, University of Marburg, Germany Homepage
  • Inga Hänelt, Frankfurt, Germany Homepage
  • João H Morais-Cabral, University of Porto, Portugal Homepage
  • Jörg Stülke, University of Göttingen, Germany Homepage
  • References

    Reviews

    Loading

    Original publications

    Loading