ybeC [2019-03-25 13:23:51]

similar to amino acid transporter

Locus: BSU02120

Isoelectric point: 9.82

Molecular weight: 59.03 kDa

Protein length: 539 aa

Gene length: 1620 bp

Function: unknown

Product: unknown

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → APC superfamily
• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of serine/ glycine/ alanine
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of alanine/ serine
• Groups of genes → Membrane proteins

Gene

Coordinates: 231,348 232,967

The protein

Protein family

• amino acid-polyamine-organocation (APC) superfamily (according to UniProt)

Paralogous protein(s)

• YveA

Localization

• membrane PubMed

Expression and Regulation

Operons

• Genes: aimA
  Description: PubMed

Biological materials

Mutant

• GP1886 ΔaimA::cat, available in Jörg Stülke's lab
• GP2786 ΔaimA::aphA3, available in Jörg Stülke's lab
• MGNA-B963 (ybeC::erm), available at the NBRP B. subtilis, Japan
• BKE02120 (aimA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATCGTAAACACCTTTCA, downstream forward: _UP4_TAAAATATAGAAGAAAACCT
• BKK02120 (aimA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATCGTAAACACCTTTCA, downstream forward: _UP4_TAAAATATAGAAGAAAACCT
• GP2831 (ΔgltT::aphA3 ΔaimA::phleo), available in Jörg Stülke's lab

LacZ fusion

• pGP2287 (in pAC5) (GP2965), available in Jörg Stülke's lab

References

Loading