fbpB [2019-03-22 10:29:14]

Fur-regulated basic protein, acts as RNA chaperone for FsrA, response to iron limitation

Locus: BSU04530

Isoelectric point: 10.73

Molecular weight: 6.88 kDa

Protein length: 59 aa

Gene length: 180 bp

Function: RNA chaperone

Product: Fur-regulated basic protein, acts as RNA chaperone for FsrA, response to iron limitation

Essential: no

Synonyms: ydbN

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Homeostasis → Acquisition of iron → Acquisition of iron / Other
• Metabolism → Additional metabolic pathways → Iron metabolism → Acquisition of iron / Other
• Information processing → RNA synthesis and degradation → RNA chaperones
• Groups of genes → Short peptides

Gene

Coordinates: 506,322 506,501

Phenotypes of a mutant

• transcription profile of a fbpA fbpB double mutant strain: GEO PubMed

Expression and Regulation

Operons

• Genes: fbpA-fbpB
  Description: PubMed

  Regulatory mechanism

  • Fur: repression, PubMed, in Fur regulon

  Regulation

  • induced by iron starvation (third wave, under extreme starvation, iron sparing response) (Fur) PubMed

Biological materials

Mutant

• BKE04530 (fbpB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTTTCTAACTCCGTCAGC, downstream forward: _UP4_TAAAAAGAGCCGGTAAGGCT
• BKK04530 (fbpB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTTTCTAACTCCGTCAGC, downstream forward: _UP4_TAAAAAGAGCCGGTAAGGCT

References

Loading