recX [2018-03-08 18:23:55]

recombination protein, modulates the SOS response and facilitates RecA-mediated recombinational repair and genetic recombination

Locus: BSU08520

Isoelectric point: 6.29

Molecular weight: 30.86 kDa

Protein length: 264 aa

Gene length: 792 bp

Function: DNA repair/ recombination

Product: recombination protein

Essential: no

Synonyms: yfhG

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Genetics → DNA repair/ recombination → Other proteins

Gene

Coordinates: 925,633 → 926,427

Phenotypes of a mutant

• reduced natural tranformation with plasmid or chromosomal DNA PubMed
• drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) PubMed

The protein

Catalyzed reaction/ biological activity

• modulates the "length or packing" of a RecA filament, thereby RecX facilitates the initiation of recombination and increases recombination across species PubMed

Protein family

• recX family (according to Swiss-Prot)

Localization

• forms foci on the nucleoid upon DNA damage PubMed
• forms foci at the cells poles and/ or the nucleoid upon induction of genetic competence PubMed

Expression and Regulation

Operons

• Genes: recX-yfhH
  Description: PubMed

Biological materials

Mutant

• MGNA-C361 (yfhG::erm), available at the NBRP B. subtilis, Japan
• BKE08520 (ΔrecX::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTTAATCTCCCTTCTCA, downstream forward: _UP4_TTACTGCAGGAAGAGGAGTA
• BKK08520 (ΔrecX::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTTAATCTCCCTTCTCA, downstream forward: _UP4_TTACTGCAGGAAGAGGAGTA

References

Loading