recX

recombination protein, modulates the SOS response and facilitates [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]-mediated recombinational repair and genetic recombination

locus: BSU_08520

pI: 6.29

mw: 30.86 kDa

protein length: 264 aa

gene length: 795 bp

function: [SW|DNA repair/ recombination]

product: recombination protein

essential: no

synonyms: yfhG

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]

Gene

Coordinates: 925,633 926,427

Phenotypes of a mutant

• reduced natural transformation with plasmid or chromosomal DNA [Pubmed|23284295]
• drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]

The protein

Catalyzed reaction/ biological activity

• modulates the "length or packing" of a [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] filament, thereby [protein|144E7D10740C5F146403612B8A0C88E02FB9C572|RecX] facilitates the initiation of recombination and increases recombination across species [Pubmed|23284295]
• inhibits [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]-catalyzed ATP hydrolysis [pubmed|28911099]
• inhibits stable [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] nucleation and polymerization on ssDNA [pubmed|28911099]
• induces [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] nucleoprotein filament depolymerization [pubmed|28911099]
• promotes a net [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] disassembly from viral ssDNAs not homologous to the host genome [pubmed|31876108]

Protein family

• recX family (single member, according to UniProt)

Structure

• [PDB|3D5L] (from Lactobacillus reuterii, 36% identity)

[SW|Localization]

• forms foci on the nucleoid upon DNA damage [Pubmed|23284295]
• forms foci at the cells poles and/ or the nucleoid upon induction of genetic competence [Pubmed|23284295]

Expression and Regulation

Operons

• genes: [gene|144E7D10740C5F146403612B8A0C88E02FB9C572|recX]-[gene|CEB1A0835C26E14E04BA99F933787C4550A96388|yfhH]
  description: [Pubmed|22383849]

Biological materials

Mutant

• GP3533 (Δ[gene|144E7D10740C5F146403612B8A0C88E02FB9C572|recX]::kan), available in [SW|Jörg Stülke]'s lab
• MGNA-C361 (yfhG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2359 NBRP B. subtilis, Japan]
• BKE08520 ([gene|144E7D10740C5F146403612B8A0C88E02FB9C572|recX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAATCTCCCTTCTCA, downstream forward: _UP4_TTACTGCAGGAAGAGGAGTA
• BKK08520 ([gene|144E7D10740C5F146403612B8A0C88E02FB9C572|recX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08520 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CATCTTAATCTCCCTTCTCA, downstream forward: _UP4_TTACTGCAGGAAGAGGAGTA

References

• 23284295,22383849,24285298,24285298,28911099,30050509,31876108