ywcE

holin, required for spore morphogenesis and germination

Locus: BSU_38130

Isoelectric point: 9.85

Molecular weight: 9.82 kDa

Protein length: 87 aa

Gene length: 264 bp

Function: required for spore morphogenesis and germination

Product: holin

Essential: no

Synonyms: ipa-41r

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Sporulation → Sporulation/ other
• Lifestyles → Sporulation → Germination → Additional germination proteins
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,914,009 3,914,272

Phenotypes of a mutant

• forms spores with a reduced outer coat PubMed

The protein

Protein family

• ywcE family (single member, according to UniProt)

Localization

• cell membrane PubMed
• spore core membran PubMed
• spore outer membran PubMed

Expression and Regulation

Operons

• Genes: ywcE
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • AbrB: repression, PubMed, in AbrB regulon
  • ResD: repression, PubMed, in ResD regulon

  Regulation

  • repressed during the log phase (AbrB), expressed only at the onset of stationary phase PubMed
  • repressed under anaerobic conditions (ResD) PubMed

Biological materials

Mutant

• BKE38130 (ywcE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATACCCGTCTCCTTTCATT, downstream forward: _UP4_TGAAGACAGCAAAAAACCCT
• BKK38130 (ywcE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATACCCGTCTCCTTTCATT, downstream forward: _UP4_TGAAGACAGCAAAAAACCCT

Labs working on this gene/protein

• Charles Moran, Emory University, NC, USA homepage

References

Loading